gRNA Design Details

Target DNA Sequence
CCGGACACTTCCCCATTGCT
PAM Sequence
TGG
Target locus
Chr.6: 127073105 - 127073127 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 86.43/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Fgf23
Entrez Gene ID
64654
Gene Name
fibroblast growth factor 23
Gene Aliases
-
Chromosome Location
Chr.6: 127072902 - 127082296 on GRCm38
UniGene ID
Mm.347933
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_022657.4 NP_073148.1 1