gRNA Design Details

Target DNA Sequence
GAACATCATGCGCCTCGTAG
PAM Sequence
GGG
Target locus
Chr.1: 206476239 - 206476261 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 96.73/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
IKBKE
Entrez Gene ID
9641
Gene Name
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Gene Aliases
IKK-E, IKK-i, IKKE, IKKI
Chromosome Location
Chr.1: 206470243 - 206496890 on GRCh38
UniGene ID
Hs.321045
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001193321.1 NP_001180250.1 5
NM_001193322.1 NP_001180251.1 6
NM_014002.3 NP_054721.1 6
XM_005273356.2 XP_005273413.1 6
XM_017002868.1 XP_016858357.1 5