gRNA Design Details

Target DNA Sequence
TGGGTACATTCCAAAACTAC
PAM Sequence
TGG
Target locus
Chr.12: 15682904 - 15682926 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 86.29/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
EPS8
Entrez Gene ID
2059
Gene Name
epidermal growth factor receptor pathway substrate 8
Gene Aliases
DFNB102
Chromosome Location
Chr.12: 15620141 - 15789576 on GRCh38
UniGene ID
Hs.591160
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_004447.5 NP_004438.3 2
XM_011520605.2 XP_011518907.1 3