gRNA Design Details

Target DNA Sequence
ATAACTGTGAGGTGGTCCTT
PAM Sequence
GGG
Target locus
Chr.7: 55142364 - 55142386 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 92.72/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
EGFR
Entrez Gene ID
1956
Gene Name
epidermal growth factor receptor
Gene Aliases
ERBB, ERBB1, HER1, NISBD2, PIG61, mENA
Chromosome Location
Chr.7: 55019032 - 55207338 on GRCh38
UniGene ID
Hs.488293
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_005228.3 NP_005219.2 2
NM_201282.1 NP_958439.1 2
NM_201283.1 NP_958440.1 2
NM_201284.1 NP_958441.1 2