gRNA Design Details

Target DNA Sequence
CGAAGACCAACTGCTCCTGC
PAM Sequence
TGG
Target locus
Chr.4: 1799276 - 1799298 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 70.25/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
FGFR3
Entrez Gene ID
2261
Gene Name
fibroblast growth factor receptor 3
Gene Aliases
ACH, CD333, CEK2, HSFGFR3EX, JTK4
Chromosome Location
Chr.4: 1793299 - 1808872 on GRCh38
UniGene ID
Hs.1420
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000142.4 NP_000133.1 3
NM_001163213.1 NP_001156685.1 3
NM_022965.3 NP_075254.1 3
XM_006713868.1 XP_006713931.1 3
XM_006713869.1 XP_006713932.1 3
XM_006713870.1 XP_006713933.1 3
XM_006713871.1 XP_006713934.1 3
XM_006713872.1 XP_006713935.1 3
XM_006713873.1 XP_006713936.1 3
XM_011513420.1 XP_011511722.1 3
XM_011513422.1 XP_011511724.1 3