gRNA Design Details

Target DNA Sequence
CACCGTACCACCGAAGATGC
PAM Sequence
AGG
Target locus
Chr.6: 131950506 - 131950528 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 93.73/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
CTGF
Entrez Gene ID
1490
Gene Name
connective tissue growth factor
Gene Aliases
CCN2, HCS24, IGFBP8, NOV2
Chromosome Location
Chr.6: 131948176 - 131951378 on GRCh38
UniGene ID
Hs.410037
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001901.2 NP_001892.1 3