gRNA Design Details

Target DNA Sequence
ATCTTTAGGATTGACACAGA
PAM Sequence
AGG
Target locus
Chr.4: 109940984 - 109941006 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 86.24/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
EGF
Entrez Gene ID
1950
Gene Name
epidermal growth factor
Gene Aliases
HOMG4, URG
Chromosome Location
Chr.4: 109912883 - 110013079 on GRCh38
UniGene ID
Hs.419815
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001178130.2 NP_001171601.1 2
NM_001178131.2 NP_001171602.1 2
NM_001963.5 NP_001954.2 2
XM_005262796.2 XP_005262853.1 2
XM_011531707.1 XP_011530009.1 3
XM_017007845.1 XP_016863334.1 2
XM_017007846.1 XP_016863335.1 2
XM_017007847.1 XP_016863336.1 2
XM_017007848.1 XP_016863337.1 2
XM_017007849.1 XP_016863338.1 2
XM_017007850.1 XP_016863339.1 2
XM_017007851.1 XP_016863340.1 2
XM_017007852.1 XP_016863341.1 2
XM_017007853.1 XP_016863342.1 2
XM_017007854.1 XP_016863343.1 2
XM_017007855.1 XP_016863344.1 2