gRNA Design Details

Target DNA Sequence
GAGCACGGAGATAACTGAGG
PAM Sequence
AGG
Target locus
Chr.7: 45890573 - 45890595 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 85.26/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
IGFBP1
Entrez Gene ID
3484
Gene Name
insulin like growth factor binding protein 1
Gene Aliases
AFBP, IBP1, IGF-BP25, PP12, hIGFBP-1
Chromosome Location
Chr.7: 45888360 - 45893668 on GRCh38
UniGene ID
Hs.642938
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000596.2 NP_000587.1 2