gRNA Design Details

Target DNA Sequence
CACTGGTCCATGTTCATTAC
PAM Sequence
TGG
Application
Gene Knock-Out
Score: 84.61/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
FIGF
Entrez Gene ID
2277
Gene Name
c-fos induced growth factor
Gene Aliases
VEGF-D, VEGFD
Chromosome Location
Chr.X: 15345591 - 15384413 on GRCh38
UniGene ID
Hs.11392
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_004469.4 NP_004460.1 7