gRNA Design Details

Target DNA Sequence
GGACGAACAATAGCTGATGT
PAM Sequence
GGG
Target locus
Chr.2: 175114819 - 175114841 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 93.55/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
ATF2
Entrez Gene ID
1386
Gene Name
activating transcription factor 2
Gene Aliases
CRE-BP1, CREB-2, CREB2, HB16, TREB7
Chromosome Location
Chr.2: 175072250 - 175168206 on GRCh38
UniGene ID
Hs.592510
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001256090.1 NP_001243019.1 9
NM_001256091.1 NP_001243020.1 8
NM_001256092.1 NP_001243021.1 7
NM_001256093.1 NP_001243022.1 7
NM_001256094.1 NP_001243023.1 8
NM_001880.3 NP_001871.2 8