gRNA Design Details

Target DNA Sequence
GCTTAGAGTGTTATCTCCAC
PAM Sequence
TGG
Target locus
Chr.9: 130854205 - 130854227 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 89.97/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
ABL1
Entrez Gene ID
25
Gene Name
ABL proto-oncogene 1, non-receptor tyrosine kinase
Gene Aliases
ABL, JTK7, bcr/abl, c-ABL, c-ABL1, p150, v-abl
Chromosome Location
Chr.9: 130713881 - 130887675 on GRCh38
UniGene ID
Hs.431048
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_005157.5 NP_005148.2 2
NM_007313.2 NP_009297.2 2