gRNA Design Details

Target DNA Sequence
CTCGAAGCGCACATCACGGT
PAM Sequence
AGG
Target locus
Chr.19: 49016239 - 49016261 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 94.55/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
LHB
Entrez Gene ID
3972
Gene Name
luteinizing hormone beta polypeptide
Gene Aliases
CGB4, HH23, LSH-B, LSH-beta
Chromosome Location
Chr.19: 49015980 - 49017090 on GRCh38
UniGene ID
Hs.154704
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000894.2 NP_000885.1 3
XM_011526975.1 XP_011525277.1 2