gRNA Design Details

Target DNA Sequence
TATGGTAGGGTGGCTCGTGT
PAM Sequence
GGG
Target locus
Chr.4: 102863670 - 102863692 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 92.09/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Sgip1
Entrez Gene ID
73094
Gene Name
SH3-domain GRB2-like (endophilin) interacting protein 1
Gene Aliases
3110007P09Rik, SGIP1alpha, gag
Chromosome Location
Chr.4: 102759167 - 102972701 on GRCm38
UniGene ID
Mm.238094
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001285852.1 NP_001272781.1 5
NM_001285859.1 NP_001272788.1 4
NM_001285860.1 NP_001272789.1 4
NM_144906.2 NP_659155.1 4