gRNA Design Details

Target DNA Sequence
AAACGTACAAGGAAGGCCTT
PAM Sequence
TGG
Target locus
Chr.1: 66625855 - 66625877 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 70.24/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
SGIP1
Entrez Gene ID
84251
Gene Name
SH3 domain GRB2 like endophilin interacting protein 1
Gene Aliases
-
Chromosome Location
Chr.1: 66533272 - 66751139 on GRCh38
UniGene ID
Hs.132121
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001308203.1 NP_001295132.1 3
NM_032291.3 NP_115667.2 2
XM_005271264.3 XP_005271321.1 2
XM_005271268.3 XP_005271325.1 2
XM_005271270.4 XP_005271327.1 3
XM_006710961.2 XP_006711024.1 2
XM_006710966.2 XP_006711029.1 2
XM_006710967.2 XP_006711030.1 2
XM_006710969.2 XP_006711032.1 2
XM_006710971.2 XP_006711034.1 2
XM_006710972.2 XP_006711035.1 2
XM_006710973.2 XP_006711036.1 2
XM_006710974.2 XP_006711037.1 2
XM_011542291.1 XP_011540593.1 2
XM_011542292.1 XP_011540594.1 2
XM_011542293.1 XP_011540595.1 2
XM_017002505.1 XP_016857994.1 2
XM_017002506.1 XP_016857995.1 3
XM_017002507.1 XP_016857996.1 2
XM_017002508.1 XP_016857997.1 3
XM_017002509.1 XP_016857998.1 2
XM_017002510.1 XP_016857999.1 3
XM_017002511.1 XP_016858000.1 3
XM_017002512.1 XP_016858001.1 3
XM_017002513.1 XP_016858002.1 2
XM_017002514.1 XP_016858003.1 2
XM_017002515.1 XP_016858004.1 2
XM_017002516.1 XP_016858005.1 3
XM_017002517.1 XP_016858006.1 3
XM_017002518.1 XP_016858007.1 3
XM_017002519.1 XP_016858008.1 3
XM_017002520.1 XP_016858009.1 2
XM_017002521.1 XP_016858010.1 2
XM_017002522.1 XP_016858011.1 3
XM_017002523.1 XP_016858012.1 3
XM_017002524.1 XP_016858013.1 3
XM_017002525.1 XP_016858014.1 3
XM_017002526.1 XP_016858015.1 2
XM_017002527.1 XP_016858016.1 3
XM_017002528.1 XP_016858017.1 3
XM_017002529.1 XP_016858018.1 2
XM_017002530.1 XP_016858019.1 2
XM_017002531.1 XP_016858020.1 2
XM_017002532.1 XP_016858021.1 2
XM_017002533.1 XP_016858022.1 3
XM_017002534.1 XP_016858023.1 2
XM_017002535.1 XP_016858024.1 3
XM_017002536.1 XP_016858025.1 2
XM_017002537.1 XP_016858026.1 3