gRNA Design Details

Target DNA Sequence
GAGGCGGGATGTTCCGAATC
PAM Sequence
TGG
Target locus
Chr.16: 22089076 - 22089098 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 84.89/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Igf2bp2
Entrez Gene ID
319765
Gene Name
insulin-like growth factor 2 mRNA binding protein 2
Gene Aliases
C330012H03Rik, IMP-2, Imp2, Neilsen
Chromosome Location
Chr.16: 22059009 - 22163299 on GRCm38
UniGene ID
Mm.489442
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_183029.2 NP_898850.2 3