gRNA Design Details

Target DNA Sequence
TGAAGTTGTCCACCAGTGCC
PAM Sequence
CGG
Target locus
Chr.6: 113484049 - 113484071 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 81.38/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Creld1
Entrez Gene ID
171508
Gene Name
cysteine-rich with EGF-like domains 1
Gene Aliases
AI843811
Chromosome Location
Chr.6: 113483297 - 113493338 on GRCm38
UniGene ID
Mm.41593
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_133930.1 NP_598691.1 1