gRNA Design Details

Target DNA Sequence
GACTGTAGCTGCCAGGAGCA
PAM Sequence
TGG
Target locus
Chr.11: 28867822 - 28867844 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 83.28/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Efemp1
Entrez Gene ID
216616
Gene Name
epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Gene Aliases
-
Chromosome Location
Chr.11: 28853205 - 28926743 on GRCm38
UniGene ID
Mm.44176
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_146015.2 NP_666127.2 4