gRNA Design Details

Target DNA Sequence
ACACCAAGTGCCGCGTACAA
PAM Sequence
AGG
Target locus
Chr.2: 31760411 - 31760433 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 91.82/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Abl1
Entrez Gene ID
11350
Gene Name
c-abl oncogene 1, non-receptor tyrosine kinase
Gene Aliases
AI325092, Abl, E430008G22Rik, c-Abl
Chromosome Location
Chr.2: 31688252 - 31807093 on GRCm38
UniGene ID
Mm.1318
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001283045.1 NP_001269974.1 1