gRNA Design Details

Target DNA Sequence
CTAGCAGCTGCACCAGGTTA
PAM Sequence
GGG
Target locus
Chr.2: 31790333 - 31790355 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 89.27/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Abl1
Entrez Gene ID
11350
Gene Name
c-abl oncogene 1, non-receptor tyrosine kinase
Gene Aliases
AI325092, Abl, E430008G22Rik, c-Abl
Chromosome Location
Chr.2: 31688252 - 31807093 on GRCm38
UniGene ID
Mm.1318
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001112703.2 NP_001106174.1 5
NM_001283045.1 NP_001269974.1 5
NM_001283046.1 NP_001269975.1 6
NM_001283047.1 NP_001269976.1 6
NM_009594.4 NP_033724.2 5