gRNA Design Details

Target DNA Sequence
CCAGTTCATCTCCAATTCGC
PAM Sequence
CGG
Target locus
Chr.7: 45465999 - 45466021 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 87.16/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Bax
Entrez Gene ID
12028
Gene Name
BCL2-associated X protein
Gene Aliases
-
Chromosome Location
Chr.7: 45461695 - 45466903 on GRCm38
UniGene ID
Mm.19904
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_007527.3 NP_031553.1 3