gRNA Design Details

Target DNA Sequence
CTCGGGCACTTTAGTGCACA
PAM Sequence
GGG
Target locus
Chr.7: 45463480 - 45463502 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 84.88/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Bax
Entrez Gene ID
12028
Gene Name
BCL2-associated X protein
Gene Aliases
-
Chromosome Location
Chr.7: 45461695 - 45466903 on GRCm38
UniGene ID
Mm.19904
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_007527.3 NP_031553.1 5