gRNA Design Details

Target DNA Sequence
TGCAGCAGGTTCTGGTACAC
PAM Sequence
AGG
Target locus
Chr.11: 7198272 - 7198294 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 80.93/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Igfbp1
Entrez Gene ID
16006
Gene Name
insulin-like growth factor binding protein 1
Gene Aliases
-
Chromosome Location
Chr.11: 7197787 - 7202546 on GRCm38
UniGene ID
Mm.21300
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_008341.4 NP_032367.3 1