gRNA Design Details

Target DNA Sequence
TGAGGCCCAGATAAATAACA
PAM Sequence
TGG
Target locus
Chr.16: 36002917 - 36002939 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 80.26/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Kpna1
Entrez Gene ID
16646
Gene Name
karyopherin (importin) alpha 1
Gene Aliases
AW494490, IPOA5, NPI1, Rch2, mSRP1
Chromosome Location
Chr.16: 35983363 - 36037136 on GRCm38
UniGene ID
Mm.6952
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_008465.5 NP_032491.2 3