gRNA Design Details

Target DNA Sequence
ATCCAGAGTGTCTGAAGAGG
PAM Sequence
TGG
Target locus
Chr.3: 102520406 - 102520428 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 86.93/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Ngf
Entrez Gene ID
18049
Gene Name
nerve growth factor
Gene Aliases
Ngfb
Chromosome Location
Chr.3: 102469919 - 102521013 on GRCm38
UniGene ID
Mm.1259
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001112698.2 NP_001106168.1 3
NM_013609.3 NP_038637.1 4