gRNA Design Details

Target DNA Sequence
ACTATGGGGTCTACACCCGG
PAM Sequence
TGG
Target locus
Chr.7: 45421629 - 45421651 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.97/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Lhb
Entrez Gene ID
16866
Gene Name
luteinizing hormone beta
Gene Aliases
LH, LH-B, LSH-B, LSH-beta
Chromosome Location
Chr.7: 45418166 - 45421855 on GRCm38
UniGene ID
Mm.57061
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_008497.2 NP_032523.2 3