gRNA Design Details

Target DNA Sequence
CGTGTACGTGATGGTTTCTT
PAM Sequence
CGG
Target locus
Chr.2: 55922360 - 55922382 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 93.58/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
EFEMP1
Entrez Gene ID
2202
Gene Name
EGF containing fibulin like extracellular matrix protein 1
Gene Aliases
DHRD, DRAD, FBLN3, FBNL, FIBL-3, MLVT, MTLV, S1-5
Chromosome Location
Chr.2: 55865962 - 55924163 on GRCh38
UniGene ID
Hs.732348
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001039348.2 NP_001034437.1 3
NM_001039349.2 NP_001034438.1 2
XM_005264205.4 XP_005264262.1 3
XM_017003586.1 XP_016859075.1 2