gRNA Design Details

Target DNA Sequence
TCGGAAAAAGACCTCTCGGG
PAM Sequence
GGG
Target locus
Chr.19: 48956224 - 48956246 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 93.45/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
BAX
Entrez Gene ID
581
Gene Name
BCL2 associated X, apoptosis regulator
Gene Aliases
BCL2L4
Chromosome Location
Chr.19: 48954825 - 48961798 on GRCh38
UniGene ID
Hs.624291
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001291428.1 NP_001278357.1 4
NM_001291429.1 NP_001278358.1 3
NM_001291430.1 NP_001278359.1 2
NM_001291431.1 NP_001278360.1 2
NM_004324.3 NP_004315.1 4
NM_138761.3 NP_620116.1 4
NM_138763.3 NP_620118.1 3
NM_138764.4 NP_620119.2 4
XM_017027077.1 XP_016882566.1 4