gRNA Design Details

Target DNA Sequence
GGACACATTTATCAGCACAG
PAM Sequence
TGG
Target locus
Chr.5: 127369911 - 127369933 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.16/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
MEGF10
Entrez Gene ID
84466
Gene Name
multiple EGF like domains 10
Gene Aliases
EMARDD
Chromosome Location
Chr.5: 127229519 - 127461222 on GRCh38
UniGene ID
Hs.438709
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001256545.1 NP_001243474.1 5
NM_001308119.1 NP_001295048.1 6
NM_001308121.1 NP_001295050.1 5
NM_032446.2 NP_115822.1 6
XM_011543694.1 XP_011541996.1 5
XM_017009987.1 XP_016865476.1 7