gRNA Design Details

Target DNA Sequence
TCGCGACGAGTACAAGCCAC
PAM Sequence
TGG
Target locus
Chr.15: 66711702 - 66711724 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 92.91/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
SMAD6
Entrez Gene ID
4091
Gene Name
SMAD family member 6
Gene Aliases
AOVD2, HsT17432, MADH6, MADH7
Chromosome Location
Chr.15: 66702110 - 66782000 on GRCh38
UniGene ID
Hs.153863
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_005585.4 NP_005576.3 2
XM_011521561.2 XP_011519863.1 2