gRNA Design Details

Target DNA Sequence
TGATGAACAAGCTTTACATC
PAM Sequence
GGG
Target locus
Chr.3: 185824937 - 185824959 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 74.02/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
IGF2BP2
Entrez Gene ID
10644
Gene Name
insulin like growth factor 2 mRNA binding protein 2
Gene Aliases
IMP-2, IMP2, VICKZ2
Chromosome Location
Chr.3: 185643739 - 185825051 on GRCh38
UniGene ID
Hs.35354
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001007225.1 NP_001007226.1 1
NM_001291869.1 NP_001278798.1 1
NM_006548.4 NP_006539.3 1
XM_017005557.1 XP_016861046.1 1
XM_017005558.1 XP_016861047.1 1
XM_017005559.1 XP_016861048.1 1
XM_017005561.1 XP_016861050.1 1
XM_017005562.1 XP_016861051.1 1
XM_017005563.1 XP_016861052.1 1
XM_017005564.1 XP_016861053.1 1