gRNA Design Details

Target DNA Sequence
CAACGTCTATGACCTCCTAA
PAM Sequence
AGG
Target locus
Chr.17: 63917792 - 63917814 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.73/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
GH1
Entrez Gene ID
2688
Gene Name
growth hormone 1
Gene Aliases
GH, GH-N, GHB5, GHN, IGHD1B, hGH-N
Chromosome Location
Chr.17: 63917193 - 63918852 on GRCh38
UniGene ID
Hs.655229
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000515.4 NP_000506.2 4
NM_022559.3 NP_072053.1 4
NM_022560.3 NP_072054.1 3