gRNA Design Details

Target DNA Sequence
GGACAAATTCTCTTCCTCCC
PAM Sequence
AGG
Target locus
Chr.3: 9934881 - 9934903 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 83.72/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
CRELD1
Entrez Gene ID
78987
Gene Name
cysteine rich with EGF like domains 1
Gene Aliases
AVSD2, CIRRIN
Chromosome Location
Chr.3: 9933788 - 9945413 on GRCh38
UniGene ID
Hs.9383
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001031717.3 NP_001026887.1 3
NM_001077415.2 NP_001070883.1 3
NM_015513.4 NP_056328.2 2
XM_011534108.1 XP_011532410.1 3
XM_017007175.1 XP_016862664.1 3