gRNA Design Details

Target DNA Sequence
GCGAAAGTTCTCTTTTCCTG
PAM Sequence
GGG
Target locus
Chr.3: 122496536 - 122496558 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 87.77/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
KPNA1
Entrez Gene ID
3836
Gene Name
karyopherin subunit alpha 1
Gene Aliases
IPOA5, NPI-1, RCH2, SRP1
Chromosome Location
Chr.3: 122421901 - 122514939 on GRCh38
UniGene ID
Hs.161008
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_002264.3 NP_002255.3 2
XM_005247437.3 XP_005247494.1 2
XM_011512795.2 XP_011511097.1 2
XM_011512797.2 XP_011511099.1 1
XM_017006363.1 XP_016861852.1 2
XM_017006364.1 XP_016861853.1 2