gRNA Design Details

Target DNA Sequence
GTTCTTCGGCTACTTCTCCG
PAM Sequence
CGG
Target locus
Chr.8: 142464348 - 142464370 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 90.67/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
ADGRB1
Entrez Gene ID
575
Gene Name
adhesion G protein-coupled receptor B1
Gene Aliases
BAI1, GDAIF
Chromosome Location
Chr.8: 142449703 - 142545009 on GRCh38
UniGene ID
Hs.194654
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq XM_011517202.2 XP_011515504.1 2