gRNA Design Details

Target DNA Sequence
CGGTGTTTCTGCTCCACAGG
PAM Sequence
AGG
Target locus
Chr.17: 16158794 - 16158816 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 88.7/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
NCOR1
Entrez Gene ID
9611
Gene Name
nuclear receptor corepressor 1
Gene Aliases
N-CoR, N-CoR1, PPP1R109, TRAC1, hN-CoR
Chromosome Location
Chr.17: 16030094 - 16216746 on GRCh38
UniGene ID
Hs.462323
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001190438.1 NP_001177367.1 3
NM_001190440.1 NP_001177369.1 5
NM_006311.3 NP_006302.2 6
XM_005256866.4 XP_005256923.1 6
XM_005256868.4 XP_005256925.1 6
XM_005256871.4 XP_005256928.1 6
XM_005256872.4 XP_005256929.1 6
XM_005256873.4 XP_005256930.1 6
XM_005256874.4 XP_005256931.1 6
XM_005256875.3 XP_005256932.1 6
XM_006721601.3 XP_006721664.1 7
XM_006721602.3 XP_006721665.1 7
XM_006721603.3 XP_006721666.1 6
XM_006721604.3 XP_006721667.1 6
XM_011524083.2 XP_011522385.1 6
XM_011524084.2 XP_011522386.1 6
XM_011524085.2 XP_011522387.1 6
XM_011524086.2 XP_011522388.1 6
XM_017025396.1 XP_016880885.1 7
XM_017025397.1 XP_016880886.1 7
XM_017025398.1 XP_016880887.1 6
XM_017025399.1 XP_016880888.1 6
XM_017025400.1 XP_016880889.1 7
XM_017025401.1 XP_016880890.1 7
XM_017025402.1 XP_016880891.1 6
XM_017025403.1 XP_016880892.1 7
XM_017025404.1 XP_016880893.1 7
XM_017025405.1 XP_016880894.1 6
XM_017025406.1 XP_016880895.1 6
XM_017025407.1 XP_016880896.1 6
XM_017025408.1 XP_016880897.1 6
XM_017025409.1 XP_016880898.1 7
XM_017025410.1 XP_016880899.1 7
XM_017025411.1 XP_016880900.1 6
XM_017025412.1 XP_016880901.1 6
XM_017025413.1 XP_016880902.1 6
XM_017025414.1 XP_016880903.1 6
XM_017025415.1 XP_016880904.1 6
XM_017025416.1 XP_016880905.1 7
XM_017025417.1 XP_016880906.1 6
XM_017025418.1 XP_016880907.1 6
XM_017025419.1 XP_016880908.1 6
XM_017025420.1 XP_016880909.1 6