gRNA Design Details

Target DNA Sequence
CGTAGACATTAGCATCAAGC
PAM Sequence
AGG
Target locus
Chr.19: 17841708 - 17841730 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 92.29/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
JAK3
Entrez Gene ID
3718
Gene Name
Janus kinase 3
Gene Aliases
JAK-3, JAK3_HUMAN, JAKL, L-JAK, LJAK
Chromosome Location
Chr.19: 17824782 - 17848071 on GRCh38
UniGene ID
Hs.515247
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000215.3 NP_000206.2 7
XM_005259896.3 XP_005259953.1 7
XM_011527990.1 XP_011526292.1 7
XM_011527991.2 XP_011526293.1 7