gRNA Design Details

Target DNA Sequence
TGCGAACCGGGCCGTGCCAA
PAM Sequence
CGG
Target locus
Chr.2: 202035347 - 202035369 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 93.73/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
FZD7
Entrez Gene ID
8324
Gene Name
frizzled class receptor 7
Gene Aliases
FzE3
Chromosome Location
Chr.2: 202034587 - 202038437 on GRCh38
UniGene ID
Hs.173859
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_003507.1 NP_003498.1 1