gRNA Design Details

Target DNA Sequence
AGCGCTGGCGCCAATGCGTC
PAM Sequence
GGG
Target locus
Chr.1: 28812468 - 28812490 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 91.82/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
OPRD1
Entrez Gene ID
4985
Gene Name
opioid receptor delta 1
Gene Aliases
OPRD
Chromosome Location
Chr.1: 28812142 - 28863696 on GRCh38
UniGene ID
Hs.372
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000911.3 NP_000902.3 1