gRNA Design Details

Target DNA Sequence
ATCACAGCCATACTCCCCGC
PAM Sequence
AGG
Target locus
Chr.19: 10638064 - 10638086 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 87.95/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Vwce
Entrez Gene ID
71768
Gene Name
von Willebrand factor C and EGF domains
Gene Aliases
1300015B04Rik
Chromosome Location
Chr.19: 10634229 - 10665210 on GRCm38
UniGene ID
Mm.169261
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_027913.1 NP_082189.1 4