gRNA Design Details

Target DNA Sequence
GCTGGATCTGATTCACCCGG
PAM Sequence
AGG
Target locus
Chr.6: 30519578 - 30519600 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.89/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Ssmem1
Entrez Gene ID
75647
Gene Name
serine-rich single-pass membrane protein 1
Gene Aliases
1700016K02Rik, 1700025E21Rik
Chromosome Location
Chr.6: 30509849 - 30520253 on GRCm38
UniGene ID
Mm.46117
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_027073.1 NP_081349.1 3
NM_029373.4 NP_083649.1 3