gRNA Design Details

Target DNA Sequence
CAATCCGGTAGCACATCGTG
PAM Sequence
AGG
Target locus
Chr.6: 119361950 - 119361972 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 91.82/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Adipor2
Entrez Gene ID
68465
Gene Name
adiponectin receptor 2
Gene Aliases
1110001I14Rik, ADCR2, AI115388, AW554121, D6Ucla1e, Paqr2
Chromosome Location
Chr.6: 119353150 - 119417483 on GRCm38
UniGene ID
Mm.291826
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_197985.3 NP_932102.2 4