gRNA Design Details

Target DNA Sequence
CATACTTAGCTGTCACTCGT
PAM Sequence
GGG
Target locus
Chr.8: 105912962 - 105912984 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 87.58/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Pskh1
Entrez Gene ID
244631
Gene Name
protein serine kinase H1
Gene Aliases
AW539964, E130013P03Rik, b2b1230Clo
Chromosome Location
Chr.8: 105900474 - 105931802 on GRCm38
UniGene ID
Mm.27627
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_173432.2 NP_775608.1 2