gRNA Design Details

Target DNA Sequence
CAATCGGACTCAGAAAGTGG
PAM Sequence
TGG
Target locus
Chr.14: 121337544 - 121337566 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 86.38/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Stk24
Entrez Gene ID
223255
Gene Name
serine/threonine kinase 24
Gene Aliases
1810013H02Rik, C76483, MST-3, Mst3, STE20
Chromosome Location
Chr.14: 121284187 - 121380006 on GRCm38
UniGene ID
Mm.390756
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_145465.2 NP_663440.1 2