gRNA Design Details

Target DNA Sequence
TCGAGCATATGCACAATGTT
PAM Sequence
GGG
Target locus
Chr.1: 74603234 - 74603256 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 88.22/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Stk36
Entrez Gene ID
269209
Gene Name
serine/threonine kinase 36
Gene Aliases
1700112N14Rik, B930045J24, FU, Fused, mKIAA1278
Chromosome Location
Chr.1: 74601450 - 74636894 on GRCm38
UniGene ID
Mm.310974
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_175031.3 NP_778196.2 3