gRNA Design Details

Target DNA Sequence
AAATTCACTGAGCGGTGACG
PAM Sequence
TGG
Target locus
Chr.11: 59375495 - 59375517 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 85.51/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Prss38
Entrez Gene ID
216797
Gene Name
protease, serine 38
Gene Aliases
Gm249, Mpn2
Chromosome Location
Chr.11: 59372669 - 59376253 on GRCm38
UniGene ID
Mm.339586
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001045521.1 NP_001038986.1 1