gRNA Design Details

Target DNA Sequence
GGACGTGGACACTCAAGTCT
PAM Sequence
TGG
Target locus
Chr.8: 71678765 - 71678787 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 90.95/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Jak3
Entrez Gene ID
16453
Gene Name
Janus kinase 3
Gene Aliases
fae, wil
Chromosome Location
Chr.8: 71676383 - 71690577 on GRCm38
UniGene ID
Mm.249645
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001190830.1 NP_001177759.1 3
NM_010589.6 NP_034719.2 3