gRNA Design Details

Target DNA Sequence
AAGTCTCCACAGGAAAATCC
PAM Sequence
AGG
Target locus
Chr.8: 83733524 - 83733546 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 82.43/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Adgre5
Entrez Gene ID
26364
Gene Name
adhesion G protein-coupled receptor E5
Gene Aliases
AA409984, Cd97, TM7LN1
Chromosome Location
Chr.8: 83723250 - 83741311 on GRCm38
UniGene ID
Mm.334648
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001163029.1 NP_001156501.1 4
NM_001163030.1 NP_001156502.1 4
NM_001163031.1 NP_001156503.1 4
NM_011925.2 NP_036055.2 4