gRNA Design Details

Target DNA Sequence
GATGCATCTCTGCCTCTCGT
PAM Sequence
TGG
Target locus
Chr.1: 75212024 - 75212046 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 86.13/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Stk16
Entrez Gene ID
20872
Gene Name
serine/threonine kinase 16
Gene Aliases
EDPK, Krct, MPSK, PKL12, TSF-1
Chromosome Location
Chr.1: 75210829 - 75215606 on GRCm38
UniGene ID
Mm.1155
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001277992.1 NP_001264921.1 3
NM_011494.5 NP_035624.3 3