gRNA Design Details

Target DNA Sequence
AGAAGCGGAAGTCTTCTCGG
PAM Sequence
GGG
Target locus
Chr.8: 95003267 - 95003289 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 92.25/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Adgrg1
Entrez Gene ID
14766
Gene Name
adhesion G protein-coupled receptor G1
Gene Aliases
Cyt28, Gpr56, TM7LN4, TM7XN1
Chromosome Location
Chr.8: 94974756 - 95014208 on GRCm38
UniGene ID
Mm.290834
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001198894.1 NP_001185823.1 3
NM_018882.3 NP_061370.2 3