gRNA Design Details

Target DNA Sequence
GTGCAAGTTCGCTCCGAAGG
PAM Sequence
AGG
Target locus
Chr.2: 119238152 - 119238174 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 96.45/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Spint1
Entrez Gene ID
20732
Gene Name
serine protease inhibitor, Kunitz type 1
Gene Aliases
HAI-1
Chromosome Location
Chr.2: 119237360 - 119249535 on GRCm38
UniGene ID
Mm.104955
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_016907.3 NP_058603.2 2